EST details — SGN-E292134

Search information 
Request: 292134Match: SGN-E292134
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82384Clone name: cLET-1-M15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184749 is on microarray TOM1: SGN-S1-1-6.2.14.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82384 [cLET-1-M15] Trace: SGN-T102588 EST: SGN-E292314 Direction: 3' Facility: TIGR
Clone: SGN-C184749 [TUS-45-J11] Trace: SGN-T198712 EST: SGN-E397386 Direction: 3' Facility: INRA
Clone: SGN-C184749 [TUS-45-J11] Trace: SGN-T198713 EST: SGN-E397387 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292134Length: 545 bp (871 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292134 [] (trimmed) CTGCATTTCACCGTGTTATTAAAGATTTCATGATTCAAGGGGGTGATTTCGACAAGGGAAATGGAACCGGTGGTAAAAGCATATATGGTCGTACC
TTCAAGGATGAAAACTTCAAGTTGGTTCATACCGGACCTGGGATTGTTAGCATGGCTAATGCAGGGCCTAATACCAACGGAAGCCAATTCTTCAT
TTGCACTGTAAAGACCCCATGGCTGGATCAAAAGCATGTTGTGTTTGGGCAAGTTTTAGAAGGCATGGACATTGTGAAGTTGATCGAGTCCCAGG
AGACTGATAGGGGTGACCGTCCAAGGAAGAGGGTTGTCATCAGTGACTGTGGTGAGCTACCTATAGTTTGAGGCGAGAATATAACTGTTTAGCAC
TTCATCTTTGCACACAATGGATATATGGACCGTTGTGAGATATAGAGCATATTCAGTAGTGAGTTTTCATCCAAATCCCAGGCTTTTTTTTTTTT
TTTTTTTAAAAGCAACAATAGTCTCTTACCATCCCATCAATATTCAATGTTAACTGAAATTGCATACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292134] SGN-U581290 Tomato 200607 Build 2 68 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102408 [Download][View] Facility Assigned ID: TMEAA80THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0041 Quality Trim Threshold: 12.5