EST details — SGN-E292129

Search information 
Request: 292129Match: SGN-E292129
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82397Clone name: cLET-1-M5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179554 is on microarray TOM1: SGN-S1-1-1.1.1.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82397 [cLET-1-M5] Trace: SGN-T102404 EST: SGN-E292130 Direction: 3' Facility: TIGR
Clone: SGN-C179554 [TUS-32-A24] Trace: SGN-T185963 EST: SGN-E372468 Direction: 3' Facility: INRA
Clone: SGN-C179554 [TUS-32-A24] Trace: SGN-T185964 EST: SGN-E372469 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292129Length: 469 bp (545 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292129 [] (trimmed) GTTTAAGCAACATTAGGGCAAGAAAGAATCTGTTATTCAAGGAACAGATTGCTCAACTGAAGGAAGAGGAAAAAATTCTATTGAAGGAAAATGTA
GACTTGAAAAAAAAGTGTCAGGTGCTACCATTGACTTTAACACCAGTTCCTCTAGTAGAGAAAGATGTTGAAAGACAAATAATGGAAGTTGAGAC
AGAGCTCTTTATAGGACTTCCAGAGACTAGAAAAAGTTCATATTGTCCTAATTTAAACACACTACCTACATTACTTTAATTGTCAAAATTGTTGG
GGTTTCAAGTTTTATATTAACACTGTAATTATAATTTATAGAGTTGTAATAATATAAACTACATTACTTAAATATAGTTTTTTTTTAATGTCTTG
AATCATTAGTTAGAGGAGAAGGTCTATCAGAAATAGCATATTTACCTCACAAAAGGTGAGGGTAAGATCTTGTATACAATAATTTGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292129] SGN-U582357 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102403 [Download][View] Facility Assigned ID: TMEAA75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5