EST details — SGN-E292100

Search information 
Request: 292100Match: SGN-E292100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82307Clone name: cLET-1-I3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179486 is on microarray TOM1: SGN-S1-1-5.3.2.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82307 [cLET-1-I3] Trace: SGN-T102373 EST: SGN-E292099 Direction: 5' Facility: TIGR
Clone: SGN-C179486 [TUS-31-O4] Trace: SGN-T185341 EST: SGN-E373899 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292100Length: 430 bp (556 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292100 [] (trimmed) AAGTTAAAACTCAATGGAATAGATGCCTGAAGCAAAAATATAATCCCATACAATTGTCAAAATTGACAAGTCTCATTCTACTAAGCATGCAAAAC
TGAGGTTTCTACCTAGTTGCAAAAGAAAAACAATATTAATAGAAAACCTTAAGGCAACAAGGATTCAAAGTTCTTTTACAAATTCACTAATCGTC
GTCTTCCTCATCGTCATCATTTCCACCAGCTGCGTTCAAAGCATTGAGTCTGTCGATCAACTTAACTTTCCTCTTTTCATAAGTCAGCTTCTTAA
GGGTGTACCTTTTGTGTGTCTTGGGAGGTTGCTTTCCAGACTTCTTTGGACTTGGGTCTGCGCGTATGGCAGCATGAACCTTTTTGTACATCTCC
TCAAGATTGTCTGCCTCAAGACCCGCCTTGATGTATAAGCTGAAGGGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292100] SGN-U578255 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102374 [Download][View] Facility Assigned ID: TMEAA50TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5