EST details — SGN-E292051

Search information 
Request: 292051Match: SGN-E292051
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82144Clone name: cLET-1-A5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179378 is on microarray TOM1: SGN-S1-1-1.2.2.13
This clone has been mapped as cLET-1-A5.
Additional sequencing 
Clone: SGN-C82144 [cLET-1-A5] Trace: SGN-T102326 EST: SGN-E292052 Direction: 3' Facility: TIGR
Clone: SGN-C179378 [TUS-31-J16] Trace: SGN-T185582 EST: SGN-E373444 Direction: 3' Facility: INRA
Clone: SGN-C179378 [TUS-31-J16] Trace: SGN-T185583 EST: SGN-E373445 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292051Length: 475 bp (547 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292051 [] (trimmed) GAAAAATGAAGTTCAATATTGTATCACCCGTTGCACTGTCTTGTCTCTTTTTCTTGTTCCTAACAGGTACTTTAGCACAAAATGCCGGTTCCATT
GTAACGCGGGAATTGTTCGAACAAATGCTGAGTTTTAGGAACAATGACGCATGTCCTGCCAAAGGATTCTACACTTATGATGCATTCATAGCTGC
AGCCAATTCGTTTCCAGGTTTTGGTACTGCTGGTGATGATACTGCACGTAAGAAGGAAATTGCTGCCTTTTTCGGTCAAACATCTCACGAAACTA
ATGGTGGTAGTGCAGGAACATTCACTGGAGGATATTGCTTTGTTAAGCAAATAGAGCAGTCAGACAGATACTATGGCAGAGGACCTATCCAATTG
ACACACCAATCTAACTACGAACGAGCTGGACAAGGTATTGGTGTTGGACAAGAGTTAGTGAACAACCCTGATTTAGTTGCGACAGATCCTATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292051] SGN-U581507 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102325 [Download][View] Facility Assigned ID: TMEAA03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5