EST details — SGN-E291793

Search information 
Request: 291793Match: SGN-E291793
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88247Clone name: cLET-7-I5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182003 is on microarray TOM1: SGN-S1-1-8.4.10.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182003 [TUS-38-H1] Trace: SGN-T194454 EST: SGN-E393128 Direction: 5' Facility: INRA
Clone: SGN-C182003 [TUS-38-H1] Trace: SGN-T194701 EST: SGN-E393375 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291793Length: 400 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291793 [] (trimmed) TAAGAGAGAAGATTGGAAGGGTATTGAAATTGAATGCCATTCAACAAGGTGATGCTTGGAAAGGAATGGATGTGTTAATTTTCAATTCTTGGCAT
TGGTGGACTCACAAGGGCAACTCTCAACCATAGGATTATGCGCAAGATGGAATGAAAGTATCAAAAGATATGGACCGTTTAATGGCATATTACAA
AGGTCTAACTACTTGGGCTAGATGGGTTGATGGAAATGTTGACTCCTCTAAGACCAAAGTGTTCTTCCAGGGCATTTCTCCAACTCATTATATGG
GTCAGGAATGGGGGGCAGCAACAAAGAATTGCAACTCAGAGCAAATACCATTAGCAGGATCGACATATCCAGCAGGGACACCAGCATCAGCAATT
GTGGTTAACAAAGTACTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291793] SGN-U571214 Tomato 200607 Build 2 120 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104046 [Download][View] Facility Assigned ID: TMEAY51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0208 Quality Trim Threshold: 14.5