Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E291778

Search information 
Request: 291778Match: SGN-E291778
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88138Clone name: cLET-7-C21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184637 is on microarray TOM1: SGN-S1-1-6.1.14.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184637 [TUS-45-E19] Trace: SGN-T198474 EST: SGN-E397148 Direction: 5' Facility: INRA
Clone: SGN-C184637 [TUS-45-E19] Trace: SGN-T200021 EST: SGN-E398695 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291778Length: 448 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291778 [] (trimmed) TGGGGTACCGGTGAGAAAGGTGTTGGAAAGATGGGGAAGCCTTTGCACTACAAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCA
AGGAGGTGATTTCACCGCCGGAAACGGGACCGGAGGAGAGTCGATCTATGGAGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGCC
CTGGAATCCTCTCCATGGCTAATGCTGGACCTGGAACCAACGGTTCTCAGTTTTTCATCTGTACCGCTAAGACTGAGTGGCTCAACGGAAAGCAC
GTCGTGTTTGGACAAGTTGTTGAAGGCATGGATGTGATTAAGAAGGCAGAGGCTGTTGGATCTAGCTCTGGAAGGTGCTCCAAGCCTGTGGTTAT
TGCTGACTGCGGTCAACTCTAGATCTGATGATGATGATGAACTAGTTTTATCAGCCTTTTATGTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291778] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104031 [Download][View] Facility Assigned ID: TMEAY23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5