EST details — SGN-E291423

Search information 
Request: 291423Match: SGN-E291423
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84706Clone name: cLET-2-A13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184529 is on microarray TOM1: SGN-S1-1-2.1.14.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184529 [TUS-45-A7] Trace: SGN-T198540 EST: SGN-E397214 Direction: 3' Facility: INRA
Clone: SGN-C184529 [TUS-45-A7] Trace: SGN-T200004 EST: SGN-E398678 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291423Length: 517 bp (911 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291423 [] (trimmed) TTCAAATTGAGCTTTTTCTCCATTAAAATTCTCTCTGCAAATTTATAGTTTTTCTTTTTTCACTTTTTGAGAAGAAATCAAAAGCTATGTGTGGT
GGTGCAATTATCTCCGATTTGGTACCTCCTAGCCGGATTTCTCGCCGGTTAACCGCTGATTTTCTATGGGGTACATCCGATCTGAACAAGAAGAA
GAAGAACCCTAGTAATTACCACTCAAAGCCCTTGAGGTCTAAGTTTATTGACCTTGAAGATGAATTTGAAGCTGACTTTCAGCACTTCAAGGATA
ATTCTGATGATGATGATGATGTGAAGGCATTTGGCCCCAAATCCGTGAGATCTGGTGATTCAAACTGCGAAGCTGACAGATCCTCCAAGAGAAAG
AGGAAGAATCAGTACCGGGGGATCAGACAGCGTCCTTGGGGTAAGTGGGCAGCTGAAATACGTGATCCAAGGAAAGGTATTCGAGTCTGGCTTGG
TACTTTCAATTCAGCCGAAGAGGCAGCCAGAGCTTATGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291423] SGN-U579115 Tomato 200607 Build 2 87 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102964 [Download][View] Facility Assigned ID: TMEAE07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5