EST details — SGN-E291335
| Search information |
| Request: 291335 | Match: SGN-E291335 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C84938 | Clone name: cLET-2-M10 |
| ||
| Library Name: cLET | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4-6 weeks
Microarray: Alias clone SGN-C184539 is on microarray TOM1: SGN-S1-1-8.1.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C184539 [TUS-45-A17] | Trace: SGN-T198454 | EST: SGN-E397128 | Direction: 3' | Facility: INRA |
| Clone: SGN-C184539 [TUS-45-A17] | Trace: SGN-T198455 | EST: SGN-E397129 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E291335 | Length: 145 bp (979 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E291335 [] (trimmed)
GAAAAAAAAACCCTAAGACGAGATGATGCTTCGAGTAGCAGGTAGAAGGCTTTCTTCTTCAGCCGCTAGATCTTCATCTAGCTTCTTTACAAGAA
GCTCTTTCACCGCTACCGATGATTCGTCTTCGGCCAGATCTCCTTGTCCG
GCTCTTTCACCGCTACCGATGATTCGTCTTCGGCCAGATCTCCTTGTCCG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E291335] | SGN-U581313 | Tomato 200607 | Build 2 | 150 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T102876 [Download][View] | Facility Assigned ID: TMEAF77TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.937 | Expected Error Rate: 0.0077 | Quality Trim Threshold: 14.5 |
Working
