EST details — SGN-E291072

Search information 
Request: 291072Match: SGN-E291072
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88606Clone name: cLET-8-M3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182013 is on microarray TOM1: SGN-S1-1-6.4.10.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182013 [TUS-38-H11] Trace: SGN-T194456 EST: SGN-E393130 Direction: 5' Facility: INRA
Clone: SGN-C182013 [TUS-38-H11] Trace: SGN-T199367 EST: SGN-E398041 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291072Length: 448 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291072 [] (trimmed) AAACACAAAGAGATTGAAAAATAAAACACATATTCATTCTTTAATAATCTTAGAGTTTTTTTTTTTTGCAACAATGGCTTCCACCATGATGACTA
CTCTACCACAGTTCAATGGACTCAAACCCCAACCTTTCTCAGCTTCTCCAATTCAAGGCTTGGTGGCAATTCAACCAAGACGCAACAAAGGACAA
GGTGGTTTGGGAGCTCGTTGTGATTTCATTGGCTCATCCACTAATTTGATAATGGTGACATCAACAAGCCTGATGTTGTTTGCTGGTAGATTTGG
TCTAGCACCATCAGCAAACAGGAAGGCAACTGCAGGGCTAAAACTTGAAGTGAGGGACTCTGGGTTACAGACAGGGGACCCTGCTGGATTTACAC
TTGCTGATACTTTGGCTTGTGGTACTGTGGGTCATATTATTGGTGTTGGAGTTGTTCTTGGACTCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291072] SGN-U575975 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104468 [Download][View] Facility Assigned ID: TMEBC74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0104 Quality Trim Threshold: 12.5