EST details — SGN-E290988

Search information 
Request: 290988Match: SGN-E290988
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88507Clone name: cLET-8-H21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184675 is on microarray TOM1: SGN-S1-1-8.3.14.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184675 [TUS-45-G9] Trace: SGN-T198564 EST: SGN-E397238 Direction: 3' Facility: INRA
Clone: SGN-C184675 [TUS-45-G9] Trace: SGN-T200009 EST: SGN-E398683 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290988Length: 541 bp (716 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290988 [] (trimmed) TTACATTTGTAAGTGTATTGTGTCTTTCCATTTTAGCTCCAAATAGTCCTTTTGCAACCAAAATCTTGTCTGAGATTTTTCTATATTTGGGATTG
ATCTAAAGATATGGTTCGAGGTAAAACCCAGATGAGGCGTATAGAGAACGCCACAAGCAGACAAGTTACTTTCTCAAAGAGAAGAAATGGTTTGC
TAAAAAAAGCTTTTGAGCTTTCTGTCTTATGTGATGCTGAAGTGGGATTGATTATATTTTCTCCAAGAGGAAAACTATATGAATTTGCTAGTTCA
AGCATACCTGAGGTAATTGAACGATATAAGAGGCATACTAAAGATAAAGTTAAATCTGATGAAAATCAATCTGTGGATATTCAGCATACTAAGCA
AGAGACAGCAAGTTTGATGAAGAAGATAGAACTCCTTGAATCATCTAAAAGGAAACTCTTGGGAGAAGGTTTAGGATCATGCAGCCTTGAAGAAG
TTCAACAATTAGAGAAGCAATTGGAGCAGAGTGTCATTACTATTAGGGCTCGAAAGATGCAAGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290988] SGN-U583095 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104384 [Download][View] Facility Assigned ID: TMEBE47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5