EST details — SGN-E290608

Search information 
Request: 290608Match: SGN-E290608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77140Clone name: cLES-20-B14
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179236 is on microarray TOM1: SGN-S1-1-7.4.2.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179236 [TUS-31-D18] Trace: SGN-T185547 EST: SGN-E373409 Direction: 3' Facility: INRA
Clone: SGN-C179236 [TUS-31-D18] Trace: SGN-T185548 EST: SGN-E373410 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290608Length: 534 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290608 [] (trimmed) GGCTGAAAAATTAGCCCCTGAGAAACGTCACAGCTTCGTTCATAATGGCCAGAAGGTGTTCGAATGGGACCAAACGCTTGAAGAATTGAACATTT
ACATAACTCTTCCAGAAAATGTTCCGAAGAAGCTATTTTATTGCAAGGTTGAGTCTAAGCATTTGGAAGTTGGGATCAAAGGCAATCCACCTTAC
CTTAATCATGATCTGATGAACCCAGTGAAGACCGATTGTTCCTTCTGGACTCTAGAGGATGATATACTGCATGTAACCTTACAGAAGAGGGATAA
AGGTCAGACATGGTCTTCTCCTATATTGGGCCAAGGACAGTTGGATCCATATGCCAGTGATCTTGAACAGAAAAGGCTCATGCTTCAAAGGTTCC
AAGAAGAGAATCCCGGTTTTGATTTCTCACAGGCACAATTCTCTGGGAATTGTCCTGATCCAAAGACCTTCATGGGGGGAATTAGCTCAACTTGA
TACTGCTCTATTATCATTGTAACTATGGACCTAACTAGATATGCATTGTTATGATGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290608] SGN-U580617 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102287 [Download][View] Facility Assigned ID: TPSDB07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0140 Quality Trim Threshold: 12.5