EST details — SGN-E290581

Search information 
Request: 290581Match: SGN-E290581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77281Clone name: cLES-20-H23
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179297 is on microarray TOM1: SGN-S1-1-2.3.2.8
See unigene SGN-U580309 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C179297 [TUS-31-G7] Trace: SGN-T185032 EST: SGN-E372575 Direction: 3' Facility: INRA
Clone: SGN-C179297 [TUS-31-G7] Trace: SGN-T185033 EST: SGN-E372576 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290581Length: 294 bp (989 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290581 [] (trimmed) CAGAAGGATTCCAGCTACAGAGCTGTTTGCAAGGGTTGATGCTGTGGATGCTAGCACCATCAAACGAGTTGCAAACAGATTTATCTTTGACCAGG
ATGTTGCTATATCCGCGCTGGGGCCTATCCAGACACTACCTGATTATAACTGGTTCAGACGCAGAACCTACATGCTCCGTTATTAGACGATTCTT
TTTTTTCTTTTTTTGGAGTTGTAATGCATCACAATTACACACCTCGCTCGACCATTCCAAACTTGGACATATAGGTCTTACTTTTCCAATTCTTC
CTCTTGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290581] SGN-U580309 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102260 [Download][View] Facility Assigned ID: TPSDA48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0176 Quality Trim Threshold: 12.5