EST details — SGN-E290568
| Search information |
| Request: 290568 | Match: SGN-E290568 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C77189 | Clone name: cLES-20-D23 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C179260 is on microarray TOM1: SGN-S1-1-7.1.2.16
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C179260 [TUS-31-E18] | Trace: SGN-T185287 | EST: SGN-E373845 | Direction: 3' | Facility: INRA |
| Clone: SGN-C179260 [TUS-31-E18] | Trace: SGN-T185288 | EST: SGN-E373846 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E290568 | Length: 251 bp (1208 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E290568 [] (trimmed)
AACACCAAGTAAAGGGCTTGATCTTTGACCAAGTTTCATCACTTGAAGAGAATCAAAAGAGTAACATTCAATGATTCCTTTATTTTTTTGATGAA
ATATAGGTTCAAATCCAGCTTAATGATGAAGCAAGACAAGCTATTGAACCACATGACGGACTAGGCCATGGAGGATTTATTTGTTTCGACTTTGA
CCTGAGCATCTAAAAGACGGAAATTGTCTTATAGTCATACAAATGCCACGGGTTATTTGTT
ATATAGGTTCAAATCCAGCTTAATGATGAAGCAAGACAAGCTATTGAACCACATGACGGACTAGGCCATGGAGGATTTATTTGTTTCGACTTTGA
CCTGAGCATCTAAAAGACGGAAATTGTCTTATAGTCATACAAATGCCACGGGTTATTTGTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E290568] | SGN-U576821 | Tomato 200607 | Build 2 | 6 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T102247 [Download][View] | Facility Assigned ID: TPSDA24TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.926 | Expected Error Rate: 0.0155 | Quality Trim Threshold: 14.5 |
Working
