Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E290484

Search information 
Request: 290484Match: SGN-E290484
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77451Clone name: cLES-20-P24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179363 is on microarray TOM1: SGN-S1-1-8.2.2.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179363 [TUS-31-J1] Trace: SGN-T185398 EST: SGN-E373260 Direction: 3' Facility: INRA
Clone: SGN-C179363 [TUS-31-J1] Trace: SGN-T185399 EST: SGN-E373261 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290484Length: 447 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290484 [] (trimmed) GTGAGGTGGAAAAAGTTCAAGTTGTTGATTCTGATTCATAACCAGATAGTGAACTTTCTGATAATCCTCCAGAGATATATGATTGTCCTGATCCA
GAGTTCAGTGATTTTGATAAGCATAGGGAAGAAAGTTGCTTTGCTGTTGACCAAATCTGGGCTTGTTATGATACAGCTGATGGAATGCCAAGATT
CTATTGTCAGATTAGGAGAGTGGCGTGTCCTGAATTTGAGCTACGGGGCACCTGGCTCGAGGCTAATCCAGAGGATCGAAGAGACATGGAGTGGG
TCGAGGCAGAATTGCCTGCTGGTTGTGGGAAATTTAAACGTGGGAGTTCTCAAATCAGTAATGATCGGCTTACATTCTCTCATCTAGTGCAGATC
ACACAGGGTAAGAGAGGTGCATTCATTGTATATCCTAGGCAAGGGGAGACATGGGCTCTCTTTAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290484] SGN-U581261 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102163 [Download][View] Facility Assigned ID: TPSDB96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5