EST details — SGN-E290400

Search information 
Request: 290400Match: SGN-E290400
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77141Clone name: cLES-20-B15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179237 is on microarray TOM1: SGN-S1-1-6.4.2.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179237 [TUS-31-D19] Trace: SGN-T185459 EST: SGN-E373321 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290400Length: 240 bp (996 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E290400 [] (trimmed) GAAGCCTGAACAAGCTAAAATCATTTATATCATCACCAATCACCTGTTAGGACTTGTAAATACTGCTGCGTTTGCATCATAAACACAATTAGATC
CGTAAATTTTAAAGCAGATATCTTTGATAAAATATCTTGTCGATATCACTTGACATGAATGCACAATGTGCTTATGAGATTCCTTTAGTCTATGA
TCAGCTCTACAAGAAGTGAAACTGAGGCATTCCTGATCATCGACTTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290400] SGN-U579053 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102079 [Download][View] Facility Assigned ID: TPSDA08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0269 Quality Trim Threshold: 14.5