EST details — SGN-E290388

Search information 
Request: 290388Match: SGN-E290388
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77350Clone name: cLES-20-K24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185271 is on microarray TOM1: SGN-S1-1-4.4.12.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185271 [TUS-46-P5] Trace: SGN-T199118 EST: SGN-E397792 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290388Length: 330 bp (1310 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E290388 [] (trimmed) AAATTCAAACTCCAATTATTTGCAGTATAAAACTACAGATACAAATCCCAGTACATGGTTTGAGGCACGATAATAAGGTGCTGATGAAATCCAAG
ACATGAGTTCACAATACATTACTGACCAATATATTTACAAAGATTAGGGTAATGGCTGCCAAATCGCTGATTACAGACAACATTCTTGGGATATA
TGCCATCTCTAAGATTAGGATTAGTGGTATGTGTGGCAGTCACAGTAGAGACCATGGCATCAACTCCGCAGATATTGTGACCCCTGCAGATCTTG
TAATATCCGTGTTCTACCCAAGACTTTCCCCAAGAATTTTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290388] SGN-U578351 Tomato 200607 Build 2 195 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102067 [Download][View] Facility Assigned ID: TPSCZ72THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0383 Quality Trim Threshold: 14.5