EST details — SGN-E290351

Search information 
Request: 290351Match: SGN-E290351
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77429Clone name: cLES-20-O21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185589 is on microarray TOM1: SGN-S1-1-6.1.9.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185589 [TUS-47-M11] Trace: SGN-T197766 EST: SGN-E396440 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290351Length: 355 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290351 [] (trimmed) TTTTGCTCCAACTTCAAAGAGAATTGTAATTGGGAAATCTGATATGTCTGGGCAGATTATGCATGCTGTTCAATACCACTCTTATGGCGGTGGAG
CTGCTGCCTTGAAGCATGTGGAAGTTCCTGTCCCTACTCCGAATAAGGATGAAGTCTTGGTAAAAGTGGAGGCTACAAGCATAAATCCTCTTGAC
TCGAAAATTCAGAAGGGCATGCTTCGTCCATTTCTTCCTTTCAAGTTTCCTTTTATTCCTACTACCGACATGGCGGGAGAGGTTGCTGAGGTAGG
ATCTAATGTAAAAAGTTTCAAGGCTGGTGACAAGGTTGTGGCTATGCTCAGTACCAAGAGTGGAGGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290351] SGN-U581242 Tomato 200607 Build 2 163 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102030 [Download][View] Facility Assigned ID: TPSCY95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0192 Quality Trim Threshold: 14.5