Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E290240

Search information 
Request: 290240Match: SGN-E290240
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87814Clone name: cLET-5-O20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184591 is on microarray TOM1: SGN-S1-1-4.3.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184591 [TUS-45-C21] Trace: SGN-T198464 EST: SGN-E397138 Direction: 5' Facility: INRA
Clone: SGN-C184591 [TUS-45-C21] Trace: SGN-T198552 EST: SGN-E397226 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290240Length: 520 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290240 [] (trimmed) TTTTGTACTATAAACTATTTCTCTTTCATTCCTTTCTCACTTTTCTTTGCTTTTGGGTTTCTGGTTTATTTTTTCTCTTCTAGTTTTGTTTTGGT
TTGATCTGCTTCGTGGGGTTCTTTATATTCTCTTGAAATCTTGAATTTTGGGTGTTTCTTGAAAATTCAAAGAGATGGAGAGGGACTTTATGGGA
TTGAATATCAAAGATTCTTTACTTGTAGTCAAGGATGAACCTGTTGAAAGCTCAAAAGACTCTGGGTTTCGCTGGCCAATGTCGAGCAAGGTTGG
TGTACCTCATTTCATGTCCTTGAACTCTGCTCAAGATGAGAACACCTTCAAAGCTCTATCTGCCACAGATGGAGTCGATGCTGGTCTCAAACGTC
AGCCTGGTGAACTCCAGAATGTGCATGCAATGCATCTTCCATATGATGTTAAGATGCTTCCATTTAACATGAACAACCCCTCCTACAAGACTCAT
TTTGGTGGTATTGGCCACATGAAGCAAGTTCTTGGTGGAATTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290240] SGN-U564449 Tomato 200607 Build 2 121 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103688 [Download][View] Facility Assigned ID: TMEAR94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5