EST details — SGN-E289246

Search information 
Request: 289246Match: SGN-E289246
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76465Clone name: cLES-18-C10
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185237 is on microarray TOM1: SGN-S1-1-6.2.11.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185237 [TUS-46-N19] Trace: SGN-T1882 EST: SGN-E378476 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185237 [TUS-46-N19] Trace: SGN-T199062 EST: SGN-E397736 Direction: 3' Facility: INRA
Clone: SGN-C185237 [TUS-46-N19] Trace: SGN-T199063 EST: SGN-E397737 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289246Length: 234 bp (320 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289246 [] (trimmed) ACATTGTACATTGTTTCGGGTTATTAAAGCCACTTATGGAAGCTTGAAACACTACTTGCTAAATCCATATCAGAACAGAAATCTGCTTTCCAACT
AGTCAAGCTTCCTCTCATGTTCGCTTAGCATATTGAGATCTTCTCTGTAGTGAATCGTCTTCTGTGATTAAAAAAAATGTAGCACCCCGCGAAGA
ATTAAAAACGAAGAAGAGTTGGTCCTTCCCCCCAGCTCATGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289246] SGN-U579403 Tomato 200607 Build 2 96 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101688 [Download][View] Facility Assigned ID: TPSCR17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5