Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C28775

Search information 
Request: 28775Match: SGN-C28775
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28775Clone name: cLEF-49-D11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176971 is on microarray TOM1: SGN-S1-1-8.2.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176971 [TUS-25-F9] Trace: SGN-T181891 EST: SGN-E368938 Direction: 3' Facility: INRA
Clone: SGN-C176971 [TUS-25-F9] Trace: SGN-T181892 EST: SGN-E368939 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248902Length: 560 bp (912 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248902 [] (trimmed) GAACAACTTCCACAGGAACAAACAATCATGAGAACTATTTCCCTTGATTCAACCTCATTTTCACTTGTTGAGTTCCATGGTACCAAGAATTTGGC
ACAAAGCAAGATCAATAGATCGGTTTCGTTGATTCCAATGGCGAGGTCTCAATTTCAGCCTAAAATAAGACGTGACATTGGTACTAGCAATAGAA
ATCCAAGTTTTAGCTGGATGGCAACAGTTGGAGAGAAAGTGCACAACTCCACGGTTCCTACTTCTGTTCCTGTTCGAGTTGCACTTGAATTGCTT
CAAGCTGGCCATCGTTATTTAGATGTCAGAACTACTGAGGAGTACAATGATGGGCATGCTGCTGGAGCCATAAACATTCCTTACATGCTTAGAAT
TGGCTCAGGGATGATAAAGAACCCCAATTTCTTGGAGGAAGTGTTGGAACAATTCGGGAAGGATGATGAGATTATAGTTGGATGCCAGTTGGGTA
AGAGATCATTTATGGCTGCAACTGAACTTCTTGCTGCTGGATTTACTGGGGTGACTGACATTGCTGGTGGATATGCTGCGTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248902] SGN-U566924 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62410 [Download][View] Facility Assigned ID: TMGHM18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5