Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E287408

Search information 
Request: 287408Match: SGN-E287408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75878Clone name: cLES-15-O2
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185541 is on microarray TOM1: SGN-S1-1-6.3.9.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185541 [TUS-47-K11] Trace: SGN-T192083 EST: SGN-E390757 Direction: 5' Facility: INRA
Clone: SGN-C185541 [TUS-47-K11] Trace: SGN-T192594 EST: SGN-E391268 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287408Length: 525 bp (912 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287408 [] (trimmed) TAATTTCTCTCTCTTACATCTTTGCTTAAGCTTTCATACTCTTTTTTTTCTTAGCAATGGCAAACGGAAAGATCAAAATCGGAATCAACGGATTC
TGTAGAATTGGTCGTTTGGTGGCTAGAGTTGCTCTACAGAGAGATGATGTTGAACTAGTTGCAGCGAATGATCCATTTATTTCCACTGATTACAT
GACATATATGTTTAAGTATGATTCAGTACATGGACAATGGAAGCATCATGAGCTAAAGGTCAAGGATGAGAAGACACTTCTCTTTGGAGAGAAGG
CTGTTACAGTTTTTGGAATCAGGAACCCTGAAGATATCCCATGGGGTGAAGCTGGTGCTGACTTCGTTGTTGAATCAACCGGTGTCTTCACTGAC
AAGGACAAGGCTGCTGCTCACTTGAAGGGTGGTGCCAAGAAGGTTGTGATCTCTGCTCCTAGCAAAGATGCTCCCATGTTTGTTGTGGGTGTCAA
CGAGAATGAATACAAGCCAGAGCTGGACATTGTCTCCAATGCTAGTTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287408] SGN-U580213 Tomato 200607 Build 2 353 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100913 [Download][View] Facility Assigned ID: TPSCF85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5