EST details — SGN-C28739

Search information 
Request: 28739Match: SGN-C28739
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28739Clone name: cLEF-49-B13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176957 is on microarray TOM1: SGN-S1-1-6.1.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176957 [TUS-25-E19] Trace: SGN-T181578 EST: SGN-E369716 Direction: 3' Facility: INRA
Clone: SGN-C176957 [TUS-25-E19] Trace: SGN-T181579 EST: SGN-E369717 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248898Length: 402 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248898 [] (trimmed) CGCAAGTTCAACTGTTGCTTCTTAGACATATGCGGAGCATGAGAAATTTCTCCATGAGAATGTTCAGCTTAAGGAAACTTCTGGAGTAATTGGTT
CGAAAGATCATGCTTATGCACAAGAAAGTATCTGCAGATCACAGGATAATCCCACTGCTTGTCCTTCAGGTCAAGATGATAAGGTTTCAGAGACT
AATGTAAGAGATTCTACTAATGAGCCACAGATGAATTCTCATAATCTAGGAAATGCTGCTGAATCTGAAGAATGTGATCCTTCAAAAGGTTCTCA
CTTGGACGTTATGCAAAATGTTTGTGAATATCCAAGACCTTCTGCTCTAGATTTCGACATTCCCATCTTAGATGTGAAGTTCACAGCCAATGAAG
ACGGTGATTCCAAGTTCTCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248898] SGN-U565270 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62406 [Download][View] Facility Assigned ID: TMGHM07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5