EST details — SGN-E287068

Search information 
Request: 287068Match: SGN-E287068
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78780Clone name: cLES-6-L6
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179092 is on microarray TOM1: SGN-S1-1-7.2.2.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179092 [TUS-30-N18] Trace: SGN-T184889 EST: SGN-E372097 Direction: 3' Facility: INRA
Clone: SGN-C179092 [TUS-30-N18] Trace: SGN-T184890 EST: SGN-E372098 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287068Length: 561 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287068 [] (trimmed) CCCACCCCCCAACGTCAATCACCACCATGCAACAAACTTTAACATATAGAAATGTGTTTCTTTCCACCACCACTACCACCACGACGATCGGTGGT
AGTTCATTCACCACCACTTCTGAGTCATGTTCAGATGTGAACAACAAGATGAAATATGTTGGTGAAATGAGATCACGATACAAAAACTCGTTTAT
TACTACGAGTGTAGCAAAATCCGTCTCGGAACACGCGATAATCGTTGTAGCGATACGTGGGTGTTGCATGTGCCATGTTGTGAAGAATTTGCTTC
TAGGGTTAGGTGTTAACCCTACGATTTTCGAAGTGAACAACGAAGATGAAGATGATGTGAAGACCGAGTTATCAATAATCACGAGTGGTGTTGGT
GATGGTGGTGGTGATGGAACAACGACGGAGTTTCCGGCGGTTTTCGTTGGTGGAAATTTGTTCGGAGGACTAGAAAGAGTGATATCCACACATAT
TTCTGGTGAATTAGTGCCAATACTAAAAGATGTAGGGGCTTTATGGCTTTAAATATTTTTACCTTCCTAGTCAATTATTATTCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287068] SGN-U573284 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98520 [Download][View] Facility Assigned ID: TPSAX63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5