EST details — SGN-E286048

Search information 
Request: 286048Match: SGN-E286048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75288Clone name: cLES-13-I15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185526 is on microarray TOM1: SGN-S1-1-5.2.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185526 [TUS-47-J20] Trace: SGN-T192492 EST: SGN-E391166 Direction: 5' Facility: INRA
Clone: SGN-C185526 [TUS-47-J20] Trace: SGN-T197779 EST: SGN-E396453 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286048Length: 150 bp (245 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286048 [] (trimmed) CAATTATCAGCCGCTTTGGTTAGGTTTTCATAACACCCACAAATTTGTTTCTCTTCAAATTTACCCATAAATTCATCTTTACATGGATTTTAATC
TGTAGAGTTTTCGTTGATTTCTTGAAAAAAAATCGGTTCTTTTGCATCACCCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286048] SGN-U569743 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100361 [Download][View] Facility Assigned ID: TPSBW56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.874 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5