EST details — SGN-E286048
| Search information |
| Request: 286048 | Match: SGN-E286048 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C75288 | Clone name: cLES-13-I15 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C185526 is on microarray TOM1: SGN-S1-1-5.2.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C185526 [TUS-47-J20] | Trace: SGN-T192492 | EST: SGN-E391166 | Direction: 5' | Facility: INRA |
| Clone: SGN-C185526 [TUS-47-J20] | Trace: SGN-T197779 | EST: SGN-E396453 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E286048 | Length: 150 bp (245 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E286048 [] (trimmed)
CAATTATCAGCCGCTTTGGTTAGGTTTTCATAACACCCACAAATTTGTTTCTCTTCAAATTTACCCATAAATTCATCTTTACATGGATTTTAATC
TGTAGAGTTTTCGTTGATTTCTTGAAAAAAAATCGGTTCTTTTGCATCACCCTCT
TGTAGAGTTTTCGTTGATTTCTTGAAAAAAAATCGGTTCTTTTGCATCACCCTCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E286048] | SGN-U569743 | Tomato 200607 | Build 2 | 49 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T100361 [Download][View] | Facility Assigned ID: TPSBW56TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.874 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 14.5 |


