EST details — SGN-E285802

Search information 
Request: 285802Match: SGN-E285802
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78289Clone name: cLES-5-D17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178943 is on microarray TOM1: SGN-S1-1-4.4.3.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178943 [TUS-30-H13] Trace: SGN-T184683 EST: SGN-E372243 Direction: 3' Facility: INRA
Clone: SGN-C178943 [TUS-30-H13] Trace: SGN-T184684 EST: SGN-E372244 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285802Length: 305 bp (792 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285802 [] (trimmed) GAAGTTTTGATGGAATTTGAGAGGATTTATGATCAGCTTTGCGGGACACAAGTTGTTTTGGTTTCATCAGAGGTGAAAATGGAGAAAGATGAAGC
TTTTGGGATCGCTAAGAAGGTGCAACAACTTAGTGGGGCTGAAAGAGTGAAGGTCAAGGTGAAGAATTTGGTTAGTGATAAGAAAAGGTCACATT
CCTTTGCTCTTTGACTTTTAATTTTTGATTCGATACGAATTTAAAATTTAGAGTCAATTTTATTTAATATGTGTGCGTGATGGATTTGTTTGTGC
CTAATCTTGATCTACTATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285802] SGN-U563515 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98285 [Download][View] Facility Assigned ID: TPSAS21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0006 Quality Trim Threshold: 12.5