Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E285795

Search information 
Request: 285795Match: SGN-E285795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78514Clone name: cLES-5-O14
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183231 is on microarray TOM1: SGN-S1-1-4.3.3.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183231 [TUS-41-K5] Trace: SGN-T191502 EST: SGN-E390176 Direction: 5' Facility: INRA
Clone: SGN-C183231 [TUS-41-K5] Trace: SGN-T191711 EST: SGN-E390385 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285795Length: 499 bp (746 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285795 [] (trimmed) GTTGCACTTGGTGGAAGAGTTGCTGAGGAGGTTATTTTTGGACAAGACAACGTAACAACTGGAGCATCTAACGATTTCATGCAAGTCTCACGAGT
GGCAAGGCAGATGGTTGAGAGATTAGGATTCAGCAAAAAGATAGGCCAAGTTGCCATTGGAGGAGGTGGTGGAAACCCTTTCCTAGGCCAACAGA
TGTCAACCCAGAAAGACTACTCCATGGCAACAGCCGATGTGGTCGATGCTGAAGTAAGTGAGTTGGTTGAAAAGGCGTACGAAAGAGCTACACAA
ATCATCACAACTCACATCGACATCCTACACAAGCTTGCTCAGCTGTTGATAGAGAAAGAAACTGTTGATGGTGAAGAGTTCATGAGCCTTTTCAT
TGATGGCAAGGCTGAGCTATACATTTCTTGATTTCACCAATGTATCTTCACCACTCTATTGTATTAACAAATATACATACAAATGTACACATTGA
GAAATTTATTTTTCATATTTTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285795] SGN-U579802 Tomato 200607 Build 2 78 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98278 [Download][View] Facility Assigned ID: TPSAR91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0