EST details — SGN-E285761

Search information 
Request: 285761Match: SGN-E285761
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78230Clone name: cLES-5-A12
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185457 is on microarray TOM1: SGN-S1-1-2.3.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185457 [TUS-47-G23] Trace: SGN-T192071 EST: SGN-E390745 Direction: 3' Facility: INRA
Clone: SGN-C185457 [TUS-47-G23] Trace: SGN-T192072 EST: SGN-E390746 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285761Length: 435 bp (779 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285761 [] (trimmed) AGCTCTTCACCACATCAAGTTTCTGTCCATTTCCCAATTTCTCAGTTATGCCACCAAAAGCAGCTAAAGGTAAAGAAGTTCCTGCCGAAAGGCCG
ATTCTTGGCCGTTTCTCATCCCACTTGAAAATTGGAATCGTAGGATTACCCAATGTGGGGAAGTCTACTCTCTTCAACACACTGACAAAGTTATC
CATTCCGGCAGAAAACTTTCCTTTTTGTACTATTGAGCCTAATGAAGCTCGAGTGCACGTTCCTGATGAGCGTTTTGAATGGCTCTGTCAACTTT
ACAAGCCCAAGAGTGAGGTGGCTGCCTTTTTGGAAATTCATGACATAGCTGGACTTGTTCGAGGTGCTCATGCAGGACAAGGATTGGGGAACAGT
TTCTTATCCCACATCCGCGCAGTTGACGGCATTTTCCATGTTCTACGCGCATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285761] SGN-U564480 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98244 [Download][View] Facility Assigned ID: TPSAR06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5