EST details — SGN-E285734

Search information 
Request: 285734Match: SGN-E285734
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78343Clone name: cLES-5-G1
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178955 is on microarray TOM1: SGN-S1-1-8.1.3.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178955 [TUS-30-I1] Trace: SGN-T184443 EST: SGN-E371829 Direction: 3' Facility: INRA
Clone: SGN-C178955 [TUS-30-I1] Trace: SGN-T184444 EST: SGN-E371830 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285734Length: 276 bp (724 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285734 [] (trimmed) AATTTGATGGATTGAGATTTATTGAGACTTTGATTACAGCTCACAGATAAGTTAACAAGAGGGGAAAAAAAAAGAAAGTAATTTTTGACAGCTTT
ATTAGTGAAAATATTATCTGAGGAAAAAATGGAATATATGAAGGTGAAATTGTATGATATTAATTTTGTTTATGGGTTTTGTTTTTGCTTAATTG
GTGTTTAATTAGGCAATTTGATGACTGTTTTTTTTTTTTTTTAATTTTAGTTTATGAGTACTATGAATGAATGAAGAGATTGAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285734] SGN-U575480 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98217 [Download][View] Facility Assigned ID: TPSAQ37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.833 Expected Error Rate: 0.0010 Quality Trim Threshold: 12.5