EST details — SGN-E285493

Search information 
Request: 285493Match: SGN-E285493
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74524Clone name: cLES-10-C21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185511 is on microarray TOM1: SGN-S1-1-4.2.10.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185511 [TUS-47-J5] Trace: SGN-T192345 EST: SGN-E391019 Direction: 5' Facility: INRA
Clone: SGN-C185511 [TUS-47-J5] Trace: SGN-T192619 EST: SGN-E391293 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285493Length: 264 bp (838 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285493 [] (trimmed) CAAAAATCAGAGAAAATTACCCAAATTCAGAAACTGAACCCTAAAATCAATGGCTGAAAAATTAGCCCCTGAGAAACGTCACAGCTTCGTTCATA
ATGGCCAGAAGGTGTTCGAATGGGACCAAACGCTTGAAGAATTGAACATTTACATAACTCTTCCAGAAAATGTTCCGAAGAAGCTATTTTATTGC
AAGGGTGAGTCTAAGCATTTGGAAGTTGGGATCAAAGGCAATCCACCTTACCTTAATCATGATCTGATGAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285493] SGN-U580617 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99633 [Download][View] Facility Assigned ID: TPSBK23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0145 Quality Trim Threshold: 12.5