EST details — SGN-E284511

Search information 
Request: 284511Match: SGN-E284511
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77899Clone name: cLES-3-K15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185443 is on microarray TOM1: SGN-S1-1-8.3.9.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185443 [TUS-47-G9] Trace: SGN-T192068 EST: SGN-E390742 Direction: 5' Facility: INRA
Clone: SGN-C185443 [TUS-47-G9] Trace: SGN-T192584 EST: SGN-E391258 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284511Length: 483 bp (753 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284511 [] (trimmed) CACTATTCTCTCAATTATATTTCTCTTCTAAAGAAAGAAAATGTTTGTCAAGATTGCTTGTTTGGTGGTTTTATGCATGTTGATTACAAATGCAC
CCCATGCAAAGGCAGTGACTTGTGGCCAAATTCAGGTTGGGGTAGTGAATTGCCTTCCTTATTTGCAGAACCGTGGGCCAATAGGAGGCTGTTGT
GGTGTCATTAAAGATTTGCTTAAGCTTTGTAAGACACCACATGAACGTAGAAAATCATGTAAGTGTGTCAAAAAAGCTGCTAATACTATTAAAGG
CATTGATTTTGGTAAAGCTGCTGGTCTTTCTGGAGTTTGTGGTGTCAAGATTCCTTTTGAGATCAGCCCCTCTGTTGACTGCTCCAAGGTGAAGT
GACGTTAATGAAAGAGATTTGCTTTCCACATCATAATATATAGTAGTAGCACAATTATGTGGACAAGAATAAGATAATTAAATCGATATTGATCC
TGCTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284511] SGN-U584460 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97532 [Download][View] Facility Assigned ID: TPSAI68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5