EST details — SGN-E283996

Search information 
Request: 283996Match: SGN-E283996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70147Clone name: cLER-13-L14
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185366 is on microarray TOM1: SGN-S1-1-5.4.10.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185366 [TUS-47-D4] Trace: SGN-T192463 EST: SGN-E391137 Direction: 3' Facility: INRA
Clone: SGN-C185366 [TUS-47-D4] Trace: SGN-T192464 EST: SGN-E391138 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283996Length: 454 bp (947 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283996 [] (trimmed) GTAAATTAAAAAAGAATGAGGAAAAAAACCTCACACACCCAAATATCTAATCCTTTTTTATACAGTCACCTCTTTTCAAGTACCAAAAACTTCTA
AAAAATGTCTATTTTAGCACCAAATTCCCAAATTTTGTACAGAGAAATCTACAATAGGGAGAATCAGCATCTGTTTTTGAACAGTGGAGGGAATG
TTAATATTGTAAAATCATATGGATTTTGTTTTGTTGATAAAAGAAGAGGTGATTGGAAGAAGAAAATGAAAAGGGAGTTAAGAATTCATGCCTCT
TGGCCAGATTTGTCAAGACCAGCTGCTGTTGAGATGCAACCAATTGAGAGTAGTGAACAACTTGATCAGATTTTAGACTCTGCTAAAGAGCTTTC
ACAACCTGTCATCATTGATTGGATGGCAGCTTGGTGCCGGAAATGCATATATTTGAAGCCTAAATTGGAGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283996] SGN-U570719 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94690 [Download][View] Facility Assigned ID: TPRBZ67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5