Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E283271

Search information 
Request: 283271Match: SGN-E283271
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69850Clone name: cLER-12-M23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185131 is on microarray TOM1: SGN-S1-1-8.2.12.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185131 [TUS-46-J9] Trace: SGN-T199042 EST: SGN-E397716 Direction: 5' Facility: INRA
Clone: SGN-C185131 [TUS-46-J9] Trace: SGN-T199100 EST: SGN-E397774 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283271Length: 422 bp (828 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283271 [] (trimmed) GGGTTGCATAATTGCACTTCATGCCCAATATGGAACATCCAACACCCAAATACAATTTGAAAAAAAATGTTGAAAACAACACCATTCATTACCAC
AATTGAAACCAATTAGGTATTCGTAACATCTCTTGTGATGCTAGATTAATGGTTCTACTATGATTGCCACACAAAAAAAAAAAAGATTTGAGTTC
ATCTGATAGACAAAATGGGAACTAACACATCCTCCCTTATACACCAACTAATAAAAATTCCCCAAAACTTCCCTCTAGGAGTGATATAGACATCA
GTCTACAAAATGCATAAACTTGCTAAGCTGGTTCTCAACTTATCACTGAATGTTTGAGGACTTGTTAAGGATAACACCTTCATATTTGACCTGGA
ACCACTTCATTGAATCCTCCTTTGTGACCCTGTGCTGGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283271] SGN-U580301 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94238 [Download][View] Facility Assigned ID: TPRBS84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0281 Quality Trim Threshold: 14.5