EST details — SGN-E282897

Search information 
Request: 282897Match: SGN-E282897
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70589Clone name: cLER-15-F10
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178741 is on microarray TOM1: SGN-S1-1-6.4.4.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178741 [TUS-29-P3] Trace: SGN-T184094 EST: SGN-E371025 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282897Length: 380 bp (796 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282897 [] (trimmed) AAAGATCAAGGAACAGTTGGATGCGGACACAGTCGTAGTGAAAGATGCTTATGGTGATGGTCGGCATGTCAGCATTGATGTAATCGCTACAGCTT
TTGAGGGACAATCAGCTGTGAATAGGCAGAGGATGGTCTACAAAGCCATATGGGAAGAACTTCAGAACACTGTGCATGCAGTCGACCAGATGACT
ACCAAAACACCAACTGAAGCAGCTGCAGGGAAGTGATAGAGGTACAACCTAAGAGTACCAAAACACCACCCCAGTCAACTACTTTATTTTCAAGT
AGCAAAACTTTTCAATTGACACATACAGTTACTATTAAAAAAAAAGAACATTGAATGATGTCAACTTTAAAGTAATATTGCTTTACATTGTTNGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282897] SGN-U566173 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95417 [Download][View] Facility Assigned ID: TPRCH29THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0092 Quality Trim Threshold: 12.5