EST details — SGN-E282848

Search information 
Request: 282848Match: SGN-E282848
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70557Clone name: cLER-15-D23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178727 is on microarray TOM1: SGN-S1-1-4.3.4.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178727 [TUS-29-O13] Trace: SGN-T183872 EST: SGN-E370531 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282848Length: 435 bp (748 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282848 [] (trimmed) AAATAAATAGGGCTAAACTCATGGTATAAATTTGTCAAAGCTATAACAATAATTACAACATAGAACCAGCAATTTCCTGGTAGGTGTAACTGATT
TCATGTATCGCCAAACATATACAATTCATAATTTTTTTTAATCCTTTCTCAATTTGAAGAATCTGAATTAAGTACAAGATAACGATATTGAAATT
CGAAGCAGTTCTAAGGTGAACGGTTTGGAGGACGAACAGAGATTTGAACTGGAATTGGGCGACCCGTACCTGTACCTCCACAGCTGCTGCAACCC
ATCCGACCCGACCCGGCACAAGTCCGACAACCTACATCTCCATCTGACCAGCGTGAACACATACATGAAACCCGACCCGTTCCATTACAACTAGG
GCACCGAGGAAACTGACTTGGACCCATCATCGTCTTCTGGTCCATAACTGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282848] SGN-U565994 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95368 [Download][View] Facility Assigned ID: TPRCG24THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5