Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E282715

Search information 
Request: 282715Match: SGN-E282715
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70554Clone name: cLER-15-D20
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178726 is on microarray TOM1: SGN-S1-1-5.3.4.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178726 [TUS-29-O12] Trace: SGN-T184024 EST: SGN-E371695 Direction: 3' Facility: INRA
Clone: SGN-C178726 [TUS-29-O12] Trace: SGN-T184025 EST: SGN-E371696 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282715Length: 500 bp (690 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282715 [] (trimmed) TTTTCCTGTAACCCATGTCACAAATGTACCTTTCTTGAACCACAATCCATCTTTTCCCGCCAGAAAATCAGGGAATTTTTGCCTCAATGCCAAGA
AAAAAAATCCATGGCTTGACCCTTTTGACTATGGTGATGATCCTGAAATGGAATATGGTTCACTTTTTTCTGAAGGGAAACAAGATGAAGATCCA
AGGCCACCTGATAATCCTGATAACCCATATGGATTTCTCAAATTCCCAATGGGATACTCTGTTGAGATTGCTTCGTTGGGTTTGAAAATTAGAGG
TGATGTTCGGAGATGTTGTTGTGTTATTGATGGTGGGGTTTATGAGAATTTGCTGTTCTTTCCAGTAATTCAGATGATTAAGGATAGGTACCCTG
GTGTTCAAGTGGATATACTTGCAACAGCCAGGGGAAAACAGACATTTGAGATGAATAAAAATGTGAGGTGGGCTAATGCCTATGATCTGGATGAT
GATTTTCCTGAACCAGCTGAGTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282715] SGN-U585939 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95235 [Download][View] Facility Assigned ID: TPRCH22THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5