EST details — SGN-E282686

Search information 
Request: 282686Match: SGN-E282686
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70638Clone name: cLER-15-H15
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178772 is on microarray TOM1: SGN-S1-1-7.1.3.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178772 [TUS-30-A10] Trace: SGN-T184483 EST: SGN-E371869 Direction: 3' Facility: INRA
Clone: SGN-C178772 [TUS-30-A10] Trace: SGN-T184484 EST: SGN-E371870 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282686Length: 452 bp (750 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282686 [] (trimmed) TAGTAGTACTCTATGTCATAGCAAAGTCTCTGTTGGCTTTTCTTTCACTAACACTTGATACAAGGTGAATTGCATTACTTCTCATCAATGCTTAT
AACATTCAAGGACAAAATGAATGTCCATAAATAATCAGCACCAAGAAATCAATATTTAGGTACGAGGAGCAATAAACAATGACTAATATTTGAAT
TATGTGTCAAAGGTGATAGCTATTCCTCAAGCAAGTTGTTCGCCAACCAGATCATCTTATAGTAGAAGTATTCTCAGAGTTTGGTTTACCATTTG
TTGTGCTGGTGCTGGTTGCCGGGCGAATAAGGTTCAAGCCGTATACATGGCCCATTTTAGCTCGTTTTGTTTCCAAATATCTCTTGTTGTCTTTT
GTAAATGGAGTAACAACGGGGACCCTACCAGAAATTGCCAAACCATAACCCTTCAGCCCGCTGTATTTTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282686] SGN-U575498 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95206 [Download][View] Facility Assigned ID: TPRCG44THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0246 Quality Trim Threshold: 14.5