EST details — SGN-E281713

Search information 
Request: 281713Match: SGN-E281713
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70462Clone name: cLER-14-P10
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183377 is on microarray TOM1: SGN-S1-1-2.1.2.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183377 [TUS-42-A7] Trace: SGN-T195936 EST: SGN-E394610 Direction: 3' Facility: INRA
Clone: SGN-C183377 [TUS-42-A7] Trace: SGN-T195936 EST: SGN-E399120 Direction: 3' Facility: INRA
Clone: SGN-C183377 [TUS-42-A7] Trace: SGN-T195937 EST: SGN-E394611 Direction: 5' Facility: INRA
Clone: SGN-C183377 [TUS-42-A7] Trace: SGN-T195937 EST: SGN-E399121 Direction: 5' Facility: INRA
Clone: SGN-C183377 [TUS-42-A7] Trace: SGN-T199400 EST: SGN-E398074 Direction: 5' Facility: INRA
Clone: SGN-C183377 [TUS-42-A7] Trace: SGN-T199567 EST: SGN-E398241 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281713Length: 267 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281713 [] (trimmed) TTGGACTGGCTCTGATATTGCAGCTGGATATTGAGGGGATAAGGTCATTTTTCCGCGCATTCTTCCGTGTGCCAAAATGGATGTGGCAGGGATTT
CTTGGTTCAAGTCTTTCTTCAGCAGACCTCATGTTATTTGCCTTCTACATGTTTATTATTGCACCAAATGACATGAGAAAAGGCTTGATCAGACA
TCTTTTATCTGATCCTACTGGTGCAACATTGATAAGAACTTATCTTACATTTTAGAGTAAACTCCTCCTACAATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281713] SGN-U567885 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94972 [Download][View] Facility Assigned ID: TPRCD89THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0153 Quality Trim Threshold: 20.5