EST details — SGN-E280659

Search information 
Request: 280659Match: SGN-E280659
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72369Clone name: cLER-1-P18
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178688 is on microarray TOM1: SGN-S1-1-3.1.3.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178688 [TUS-29-M22] Trace: SGN-T183947 EST: SGN-E371618 Direction: 3' Facility: INRA
Clone: SGN-C178688 [TUS-29-M22] Trace: SGN-T183948 EST: SGN-E371619 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280659Length: 376 bp (804 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280659 [] (trimmed) GTCTGATCCTCGTATCACTTATGAAATACGCAGCATTTGGATCACATACTGGTCTCAGGCTGACAAGTCTTTGGGTCAAAAGCTTGCATCTAGGC
TTAATGTGAGACCAAGCATATGAAGACGAAGCTTTTAAATGGTTTCAGAGGAGGATGCAAGAGTTTTAATAACTCATTCCACTTATATAGCAAGA
TGTATAATGCGATGGATGATCATATTTAGATGAAATAAGGAGCATTTCCAATACATATGCATTTGTTATTGTGTTGCTGTTGTAATATGAATGAA
TGAGTGAGTGAAGCAATGGAAATTACAAATAATATTTCTGTACTAAGTTGTACACTTATTATCAGTATTGTCATGAATGTTTTTGGTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280659] SGN-U578479 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92213 [Download][View] Facility Assigned ID: TPRAD93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0030 Quality Trim Threshold: 12.5