EST details — SGN-E280656

Search information 
Request: 280656Match: SGN-E280656
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72363Clone name: cLER-1-P12
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178682 is on microarray TOM1: SGN-S1-1-1.1.4.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178682 [TUS-29-M16] Trace: SGN-T1506 EST: SGN-E378766 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178682 [TUS-29-M16] Trace: SGN-T183945 EST: SGN-E371616 Direction: 3' Facility: INRA
Clone: SGN-C178682 [TUS-29-M16] Trace: SGN-T183946 EST: SGN-E371617 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280656Length: 424 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280656 [] (trimmed) AGATGCCAGTGGAAGATTCCAATTCAAGGAAGTAGAAGGCTCTGAAGAAATTATCGGGGCTGATCTGGTTATGCTAGCCATGGGGTTCCTTGGTC
CTGAATCGACAATAGCAGACAAACTAGGATTAGAAAAGGACAACAGGTCCAACTTCAAGGCTGATTATGGACGCTTCTCAACTAGTGTGGAGGGG
GTGTTTGCTGCAGGAGACTGTCGTAGGGGACAGTCTTTGGTGGTTTGGGCCATCTCTGAAGGACGACAAGCAGCTGCTCAAGTTGACAAGTTTCT
CATGAAGGATGACGAGGACTCGTCTGGTGATGCAGCTAGCCAACAAGAATCTGTCAAAAAGCAGCCAACAGTCGTGACATAAGACACTTGCTTTT
GGCGGAGGCTGGTTTTAGTAATCTTTCTTCAAACAACTTCCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280656] SGN-U575484 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92210 [Download][View] Facility Assigned ID: TPRAD90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0113 Quality Trim Threshold: 14.5