Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E280470

Search information 
Request: 280470Match: SGN-E280470
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72055Clone name: cLER-1-A19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178428 is on microarray TOM1: SGN-S1-1-7.3.4.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72055 [cLER-1-A19] Trace: SGN-T92023 EST: SGN-E280469 Direction: 5' Facility: TIGR
Clone: SGN-C178428 [TUS-29-C2] Trace: SGN-T183887 EST: SGN-E371558 Direction: 3' Facility: INRA
Clone: SGN-C178428 [TUS-29-C2] Trace: SGN-T183888 EST: SGN-E371559 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280470Length: 491 bp (797 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280470 [] (trimmed) GCCCCCCCTTTCAACTTCAAGAAGGACCGTGATGGCTACTGGAAGTGGTTTGCTGGAAACCTTGCATCAAGAGGTGCTGCTGGTGCTTCCTCTTT
GGTCTTTGTCTACTCCTTGGACTATGCTCGTACCCGTCTTGCTAATGATGCCAAGGCTTCAAAGAAGGGAGGTGAGAGGCAGTTCAATGGTTTGG
TTGATGTCTACAGGAAGACACTCAAATCTGATGGAATTGCTGGTCTATACCGTGGATTCAACATTTCATGTGTTGGTATCATTGTTTACCGTGGT
TTGTACTTAGGAATGTACGACTCCTTGAAGCCTGTCCTCTTGACAGGAAACCTGCAGGATAGTTTCTTTGCTAGCTTTGCTCTTGGTTGGCTCAT
CACCAATGGTGCTGGTCTTGCTTCTTACCCCATTGATACAGTAAGATGAAGAATGATGATGACATCTGGTGAGGCGGTGAAGTACAGGAGCTCGC
TTGATGCATTCTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280470] SGN-U577960 Tomato 200607 Build 2 307 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92024 [Download][View] Facility Assigned ID: TPRAA10TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0142 Quality Trim Threshold: 20.5