EST details — SGN-E280439

Search information 
Request: 280439Match: SGN-E280439
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72251Clone name: cLER-1-J8
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178591 is on microarray TOM1: SGN-S1-1-4.1.3.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178591 [TUS-29-I21] Trace: SGN-T183848 EST: SGN-E370507 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280439Length: 436 bp (815 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280439 [] (trimmed) AGCCCAATCACAATGTTCATTCATATGGCTTCTCCAATGAGGCCCAAACCATATCAAGTACAAAGCCCAAAAGGCCTAAAAGATTATTTAAGGAA
CGACCAAAACTAAAATCTACTTTCTTCCATAAAAGTTTCGAAATAGAAATAAATCAAAATAAAATAGCCAAAGTTAACACAATGACTTTCATCTT
GAAGACTCTTATTCATCATCCCCTTACCAATTTATCATGACCACCACAACCATACTCACTTATTTAGGAAAAACTAATATTTCTCATAATCCTTG
CTTAGAAAACTATAATTACATTCAAGCATCAGCAATTTCAGCTTCATCAGCTGCAGCCAACATAAGCTCCGGGAGGACGCTTGTTTCTGCAGTTC
CATCAAAGGCGTTGGGCAATCCCAACGCTCGTAGGGCGAGGTGAGCTGCCTTCTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280439] SGN-U580030 Tomato 200607 Build 2 241 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91993 [Download][View] Facility Assigned ID: TPRAD52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5