EST details — SGN-E280420

Search information 
Request: 280420Match: SGN-E280420
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72078Clone name: cLER-1-B24
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178449 is on microarray TOM1: SGN-S1-1-2.3.4.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178449 [TUS-29-C23] Trace: SGN-T183825 EST: SGN-E370484 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280420Length: 370 bp (798 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280420 [] (trimmed) TTTTTTTGCAACAATGGCTTCCACCATGATGACTACTCTACCACAGTTCAATGGACTCAAACCCCAACCTTTCTCAGCTTCTCCAATTCAAGGCT
TGGTGGCAATTCAACCAAGACGCAACAAAGGACAAGGTGGTTTGGGAGCTCGCTGTGATTTCATTGGCTCATCCACTAATTTGATAATGGTGACA
TCAACAAGCCTGATGTTGTTTGCTGGTAGATTTGGTCTAGCACCATCAGCAAACAGGAAGGCAACTGCAGGGCTAAAACTTGAAGTGAGGGACTC
TGGGTTACAGACAGGGGACCCTGCTGGATTTACACTTGCTGATACTTTGGCTTGTGGTACTGAGGGTCATATTATTGGTGTTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280420] SGN-U575975 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91974 [Download][View] Facility Assigned ID: TPRAD12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0083 Quality Trim Threshold: 12.5