Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E280395

Search information 
Request: 280395Match: SGN-E280395
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72195Clone name: cLER-1-H13
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189629 [TUS-58-E19] Trace: SGN-T339718 EST: SGN-E538843 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189629 [TUS-58-E19] Trace: SGN-T339720 EST: SGN-E538845 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280395Length: 279 bp (734 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280395 [] (trimmed) GAAAAAAAAATCCATTCTATGAAGTCACAACTACTTTACAGGGCCCTCAAACAATCAAAATTCAAAAAATATATTATGATATTCATTTTCCGGGG
ACAAAGTTTGTGGCGAAAGCCCAAGCGTTGTTGTTAACGGGGTCTGCAAGGGGGTCAGCAAGGTTTTCCAATGGACCCTTTCCGGTAACAATGGC
CTGAACATTATGCAAAAGATGCAGCTTATAATACCAATAGGGGGGCAGCTACACTGTACAGAAGCAGTGCTAAGCATTTTGATTCAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280395] SGN-U590115 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91949 [Download][View] Facility Assigned ID: TPRAC43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5