Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E280356

Search information 
Request: 280356Match: SGN-E280356
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72135Clone name: cLER-1-E16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178499 is on microarray TOM1: SGN-S1-1-8.2.4.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178499 [TUS-29-F1] Trace: SGN-T184048 EST: SGN-E370979 Direction: 3' Facility: INRA
Clone: SGN-C178499 [TUS-29-F1] Trace: SGN-T184049 EST: SGN-E370980 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280356Length: 557 bp (825 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280356 [] (trimmed) AACATTCCTAAGAAGTAAACCATTGACAGTAGTTCCACGGGCATCGAAAAGGAAGAGTAAACCTCACTGATTTTTAAGGCCTGAACCATGATATG
AAATAAGTCGATAAAGTCTAAATCCAATTTCCAAAATTCGAAAGGTAAATGCGCAATATGTGACTCACCTGACGATCTTATTCTAAATAGTATCT
CGGTAGACAACCACTATGTTTATATCCTTTCTTTCTCATACAAAGTGCTTATACACTTAACAAAACCACTTTTTCTTTGAACAGTAAAGAGAGAA
CCAAATAAAAAACGGGTCCGGCCCTCCTCAGTATCACCTAGGAAGAGGCCATTGATTGGAATAGAAAATTTAGTAAGAATTAGGTTCGAATAAAT
TTCCTGGGATCCTTTTCCTTTCGAACTACAAACATGGGAATCGCTGAAATAGTTCTTTGATTGAAAGAGGCTGATTCCTATAATACATTACTCCA
GTCGAGTCCAATGGAATTTCAAAATGAAGATATTTTTATTTTGTTCCAAACGTGTTGCAAAACCATCTAGAAAGCAATTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280356] SGN-U579372 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91910 [Download][View] Facility Assigned ID: TPRAB32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5