EST details — SGN-E280282

Search information 
Request: 280282Match: SGN-E280282
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72149Clone name: cLER-1-E9
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178514 is on microarray TOM1: SGN-S1-1-1.2.4.18
See unigene SGN-U579030 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C72149 [cLER-1-E9] Trace: SGN-T91835 EST: SGN-E280281 Direction: 5' Facility: TIGR
Clone: SGN-C178514 [TUS-29-F16] Trace: SGN-T1495 EST: SGN-E378394 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178514 [TUS-29-F16] Trace: SGN-T184193 EST: SGN-E371426 Direction: 3' Facility: INRA
Clone: SGN-C178514 [TUS-29-F16] Trace: SGN-T184194 EST: SGN-E371427 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280282Length: 536 bp (822 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280282 [] (trimmed) GGAGTTAATGCAAGACATTTACCGTACATATTAGCTGGTCATAGGATTCAACATACACAACAAGAACGTTAAAACTCCAACGTCTACAATAAGTT
TGTGAAGAAGACAACAGTATATAGCATACCAGAACATCAAAATCTTATATCAAGTCTTACAGCAATCAAAGGTGGTGTTCTGCCTAGCCAAATTC
CCGAATACGAAAGGTTATACAGAGCTGGTCCAAATCCTAGCTGCTTACAAGTTTTGCTCCAAAGCACAGAAATCCAATTCACCTCTCTACTTAGG
ATTTCGGAGGACAATGATCACAGAATCTCCCCGAAGGAACATCTTGCTGATAAACCTATCTTTGTTAACAGCAACAGCTTTCTTTTTTCCTTTTC
CAGTCTTGGGCACCTCAGTCCACATTTCTCTAACATTTTCAAGCACCATATTGCAGTGACGATCAAATGCTCTCACACGACCAAGAAGTTTCCTG
TTGGTCCTACAGTTGATGAGCACCTCGGTGTTATTCTTAACACTCATCATGAGGACAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280282] SGN-U579030 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91836 [Download][View] Facility Assigned ID: TPRAA29TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5