Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E278732

Search information 
Request: 278732Match: SGN-E278732
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73019Clone name: cLER-2-O11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185929 is on microarray TOM1: SGN-S1-1-2.3.7.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185929 [TUS-48-K15] Trace: SGN-T188275 EST: SGN-E376235 Direction: 3' Facility: INRA
Clone: SGN-C185929 [TUS-48-K15] Trace: SGN-T188276 EST: SGN-E376236 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278732Length: 190 bp (850 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278732 [] (trimmed) CGNCGCCTCCGCCGACCGGTTGTTATTCAGGTTGCGTGGCTACTGGTATCGACTGTCTGACCTCCTGTCGTAGGCCACCGGCGACCTCGGACGAT
GTTATTTAGGGAGTGTATGAGATGCTAGCTTCCTATACTTAAAATTGTCGAAATAAATAAATTGTGATGCATAGTAATATTTCATATTACAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278732] SGN-U577953 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92450 [Download][View] Facility Assigned ID: TPRAE90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0159 Quality Trim Threshold: 12.5