EST details — SGN-E278717

Search information 
Request: 278717Match: SGN-E278717
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72846Clone name: cLER-2-G19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185302 is on microarray TOM1: SGN-S1-1-5.1.9.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185302 [TUS-47-A12] Trace: SGN-T191919 EST: SGN-E390593 Direction: 5' Facility: INRA
Clone: SGN-C185302 [TUS-47-A12] Trace: SGN-T197638 EST: SGN-E396312 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278717Length: 465 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278717 [] (trimmed) TACATTCTCTCTTGCCCTCCCGCCGATCAGAGCCATTCTCTTCAACAATTTCAAGAGATGGGTGAAACACCAGTTCCAGAGTCAGTTTTGAAGAA
GCAGAAGAGGAGCGAGGAATGGGCTCTTGCAAAGAAGCAAGAACTTGAATCTGCAAAGAAGAAGAATGCTGAGAACAGGAAATTGATCTACAACA
GGGCAAAGCTGTATGCAAAGGAGTATGCAGAACAGGACAAGGAATTGATCCGTTTGAAACGTGAGGCTAGATTGAAAGGTGGTTTCTATGTGGAT
CCTGAGGCAAAGTTGTTGTTTATCATCAGAATACGCGGTATTAACGCTATGCCCCCACAGACCAAAAAGATTTTGCAGCTACTACGTTTGCGCCA
GATCTTTAATGGTGTCTTTTTGAAAGTCAACAAGGCCACAGTGAACATGTTGCATAGGGTTGAACCTTACGTTACCTATGGTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278717] SGN-U580567 Tomato 200607 Build 2 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92435 [Download][View] Facility Assigned ID: TPRAE46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0141 Quality Trim Threshold: 14.5