EST details — SGN-C27828

Search information 
Request: 27828Match: SGN-C27828
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27828Clone name: cLEF-45-K3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176762 is on microarray TOM1: SGN-S1-1-1.1.9.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176762 [TUS-24-M16] Trace: SGN-T193103 EST: SGN-E391777 Direction: 5' Facility: INRA
Clone: SGN-C176762 [TUS-24-M16] Trace: SGN-T199145 EST: SGN-E397819 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246514Length: 562 bp (1071 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246514 [] (trimmed) CTTCTCTTTCTCTCTCTCTCTCTCCTGCTCTTTCTTCTTCTTCTTTCTTCCCCTGGATCTTCAAACCCAACCCAATCTCTCCAAAAATCATTAAA
AAAATCGAAACAATCCTTTAATTTCTGTGTTTTTTAACACATTTTACTCTTTTTAACTTTTTTTTTGGGATTGATCTGGTTTAGAAACGGTTCTG
ATTTGATCACATCGTGGGAGATTGATAAAAGGGGAAGATCCTTTCGTCATATAAAGAAGTGGGTTTGCGTTTAAAAGGTCTGCAAAAGAAGCAAG
GGAAGTGAGAGGCGGCAAGGACGGGGCACTAGATGAGCGACAGCTAATTAGTCTTGTACTTTTTTATAAGCTGTCCGTTAGAGGGCTGAATAAAA
TAGGAAAGAGTTACCCAGTGGTGCAGCGGCTGGAAGAAGTTTAGTACAGGGTTGATAGAAAATCCTTATTCTATATTACCTAGTCCTTCTTCACC
TTTCATTATACAACTTGTATTATCTGAGATTCCTTTCTTCTCTTTTTAAACCAATTCCTAAGTGGAAGTGTTTTGTCTTATATATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246514] SGN-U564987 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61249 [Download][View] Facility Assigned ID: TMGGU62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0