Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E277590

Search information 
Request: 277590Match: SGN-E277590
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73891Clone name: cLER-6-M6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185330 is on microarray TOM1: SGN-S1-1-1.2.9.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185330 [TUS-47-B16] Trace: SGN-T192457 EST: SGN-E391131 Direction: 3' Facility: INRA
Clone: SGN-C185330 [TUS-47-B16] Trace: SGN-T192458 EST: SGN-E391132 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277590Length: 362 bp (766 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277590 [] (trimmed) AAGGAAGGAGAGCCACCCACACCATTTTATTTATAGAAAATATTGTAAAGCTCCATTGCTGGCAGTAGCAGTGAAATGAGAGCAATTGAAATATA
CTGGTATGGGGGCTTAGCCGCTTCCACTCTATCACAATCATCATTGTCGTGTATTTCCAAGGTTCATCAGAGATGCCTGCGAACAAAAATCAAAG
CAGTTGCAAGTAGTCATGAGAAGGAAGAGGCTTGTGTGAAGTTTGCCTTTGTCAGCTCAGTACTCCTACCAGATGGGACACCAGATGTGCAGCTA
AGGAAAGCATGTGGCGGCCAAAAACTTAGGGACATAATGCTCGATGCTAATGTCGAGTTGTATGGACCTTATGCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277590] SGN-U575491 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93320 [Download][View] Facility Assigned ID: TPRAV75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5