Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E276790

Search information 
Request: 276790Match: SGN-E276790
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66594Clone name: cLEN-14-M19
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C181001 is on microarray TOM1: SGN-S1-1-2.2.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181001 [TUS-35-N7] Trace: SGN-T196417 EST: SGN-E395091 Direction: 5' Facility: INRA
Clone: SGN-C181001 [TUS-35-N7] Trace: SGN-T197727 EST: SGN-E396401 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276790Length: 487 bp (746 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276790 [] (trimmed) TTAAGGACTGCCAATGCTTGCCTATCTCGTTATTCTTCTCATCATCGGACTTTTTCTGCGCTTCCGAATTTTGCCCCTGATGATAAGCAAAGCAC
CAACTCGTTTGAGTCTGCTGAGGACTTTGAAAGACGAATTTTTGGTGATAGTGCGGGTAACAGGCCAAGTCCAAACTCCTTTTTCAGAAAGCTTG
ATGACGCTGAAAAGTCTTATGATAGATCTGGTCTGGGCTCCACATTTAGTTCTGGAAACAGATCTAGTATCCTTGATGGTCTAGATGAGAGTTTT
AATACATTATCAGATGGGATGGATGGTAAGCTGAAGGAAGCAGCCAGCTATTTTCAGGTGGATCCTGAAGAAGTAGGAAAAGAAGATTATGCTTA
CAGAGCAGATATGACCTTTTGGCCCGGAAACACTTATGAACTCAAGGATCTTGATCTTAGAAAACCAGGAGTTCGCAGGCCCCCAAAAAGGGATG
AATTTGAAACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276790] SGN-U571977 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90336 [Download][View] Facility Assigned ID: TRRCA82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5